Mature sequence xtr-miR-142-3p

Accession numberMIMAT0003603
IDxtr-miR-142-3p
Stem-Loop xtr-mir-142-1 xtr-mir-142-2
Sequence
uguaguguuuccuacuuuaugga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1