Mature sequence xtr-miR-142-3p

Accession numberMIMAT0003603
IDxtr-miR-142-3p
Sequence
uguaguguuuccuacuuuaugga
Get sequence
Stem-Loop xtr-mir-142-1 xtr-mir-142-2

References

1