Mature sequence xtr-miR-192

Accession numberMIMAT0003615
IDxtr-miR-192
Sequence
augaccuaugaauugacagcc
Get sequence
Stem-Loop xtr-mir-192

References

1