Mature sequence xtr-miR-194

Accession numberMIMAT0003617
IDxtr-miR-194
Sequence
uguaacagcaacuccaugugga
Get sequence
Stem-Loop xtr-mir-194-1 xtr-mir-194-2

References

1