Mature sequence xtr-miR-199a-5p

Accession numberMIMAT0003618
IDxtr-miR-199a-5p
Previous IDsxtr-miR-199a
Sequence
cccaguguucagacuaccuguuc
Get sequence
Stem-Loop xtr-mir-199a

References

1