Mature sequence xtr-miR-199a-3p

Accession numberMIMAT0003619
IDxtr-miR-199a-3p
Previous IDsxtr-miR-199a*
Sequence
uacaguagucugcacauugguu
Get sequence
Stem-Loop xtr-mir-199a

References

1