Mature sequence xtr-miR-206

Accession numberMIMAT0003623
IDxtr-miR-206
Sequence
uggaauguaaggaagugugugg
Get sequence
Stem-Loop xtr-mir-206

References

1