Mature sequence xtr-miR-206

Accession numberMIMAT0003623
IDxtr-miR-206
Stem-Loop xtr-mir-206
Sequence
uggaauguaaggaagugugugg
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1