Mature sequence xtr-miR-181a-5p

Accession numberMIMAT0003625
IDxtr-miR-181a-5p
Previous IDsxtr-miR-181a
Sequence
aacauucaacgcugucggugagu
Get sequence
Stem-Loop xtr-mir-181a-1 xtr-mir-181a-2

References

1