Mature sequence xtr-miR-181a-1-3p

Accession numberMIMAT0003626
IDxtr-miR-181a-1-3p
Previous IDsxtr-miR-181a*;xtr-miR-181a-1*
Sequence
accaucgaucguugacuguaca
Get sequence
Stem-Loop xtr-mir-181a-1

References

1