Mature sequence xtr-let-7c

Accession numberMIMAT0003644
IDxtr-let-7c
Stem-Loop xtr-let-7c
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1