Mature sequence xtr-let-7f

Accession numberMIMAT0003645
IDxtr-let-7f
Stem-Loop xtr-let-7f
Sequence
ugagguaguagauuguauaguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1