Mature sequence xtr-miR-18a-5p

Accession numberMIMAT0003652
IDxtr-miR-18a-5p
Previous IDsxtr-miR-18a
Sequence
uaaggugcaucuagugcagauag
Get sequence
Stem-Loop xtr-mir-18a

References

1