Mature sequence xtr-miR-93a

Accession numberMIMAT0003659
IDxtr-miR-93a
Stem-Loop xtr-mir-93a
Sequence
aaagugcuguucgugcagguag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1