Mature sequence xtr-miR-93b

Accession numberMIMAT0003660
IDxtr-miR-93b
Sequence
aagugcuguucgugcagguag
Get sequence
Stem-Loop xtr-mir-93b

References

1