Mature sequence xtr-miR-148a

Accession numberMIMAT0003664
IDxtr-miR-148a
Stem-Loop xtr-mir-148a
Sequence
ucagugcacuacagaacuuugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1