Mature sequence xtr-miR-148a

Accession numberMIMAT0003664
IDxtr-miR-148a
Sequence
ucagugcacuacagaacuuugu
Get sequence
Stem-Loop xtr-mir-148a

References

1