Mature sequence xtr-let-7e

Accession numberMIMAT0003666
IDxtr-let-7e
Stem-Loop xtr-let-7e-1 xtr-let-7e-2
Sequence
ugagguaguagguuguuuaguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1