Mature sequence xtr-miR-23b

Accession numberMIMAT0003673
IDxtr-miR-23b
Stem-Loop xtr-mir-23b
Sequence
aucacauugccagggauuacc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References