Mature sequence xtr-miR-25

Accession numberMIMAT0003674
IDxtr-miR-25
Sequence
cauugcacuugucucggucuga
Get sequence
Stem-Loop xtr-mir-25-1 xtr-mir-25-2

References

1