Mature sequence xtr-miR-25

Accession numberMIMAT0003674
IDxtr-miR-25
Stem-Loop xtr-mir-25-1 xtr-mir-25-2
Sequence
cauugcacuugucucggucuga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1