Mature sequence xtr-miR-124

Accession numberMIMAT0003683
IDxtr-miR-124
Sequence
uuaaggcacgcggugaaugcca
Get sequence
Stem-Loop xtr-mir-124

References

1