Mature sequence xtr-miR-143

Accession numberMIMAT0003686
IDxtr-miR-143
Sequence
ugagaugaagcacuguagcucg
Get sequence
Stem-Loop xtr-mir-143

References

1