Mature sequence xtr-miR-143

Accession numberMIMAT0003686
IDxtr-miR-143
Stem-Loop xtr-mir-143
Sequence
ugagaugaagcacuguagcucg
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1