Mature sequence xtr-miR-196a

Accession numberMIMAT0003690
IDxtr-miR-196a
Stem-Loop xtr-mir-196a
Sequence
uagguaguuucauguuguugg
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1