Mature sequence xtr-miR-200a

Accession numberMIMAT0003693
IDxtr-miR-200a
Sequence
uaacacugucugguaacgaugu
Get sequence
Stem-Loop xtr-mir-200a

References

1