Mature sequence xtr-miR-200a

Accession numberMIMAT0003693
IDxtr-miR-200a
Stem-Loop xtr-mir-200a
Sequence
uaacacugucugguaacgaugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1