Mature sequence xtr-miR-133a

Accession numberMIMAT0003708
IDxtr-miR-133a
Sequence
uugguccccuucaaccagcugu
Get sequence
Stem-Loop xtr-mir-133a

References

1