Mature sequence xtr-miR-133a

Accession numberMIMAT0003708
IDxtr-miR-133a
Stem-Loop xtr-mir-133a
Sequence
uugguccccuucaaccagcugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1