Mature sequence mmu-miR-712-3p

Accession numberMIMAT0003743
IDmmu-miR-712-3p
Previous IDsmmu-miR-712*
Stem-Loop mmu-mir-712
Sequence
ugcgagucacccccggguguug
Get sequence
Deep sequencing209 reads, 48 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).