Mature sequence bta-miR-199a-3p

Accession numberMIMAT0003746
IDbta-miR-199a-3p
Previous IDsbta-miR-199a*
Stem-Loop bta-mir-199a-1 bta-mir-199a-2
Sequence
acaguagucugcacauugguua
Get sequence
Deep sequencing733416 reads, 68 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).