Mature sequence dre-miR-15c

Accession numberMIMAT0003764
IDdre-miR-15c
Stem-Loop dre-mir-15c
Sequence
aagcagcgcgucaugguuuuc
Get sequence
Deep sequencing14896 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).