Mature sequence bta-miR-450a

Accession numberMIMAT0003834
IDbta-miR-450a
Previous IDsbta-miR-450
Stem-Loop bta-mir-450a-2 bta-mir-450a-1
Sequence
uuuugcgauguguuccuaauau
Get sequence
Deep sequencing10304 reads, 69 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).