Mature sequence bta-miR-200b

Accession numberMIMAT0003842
IDbta-miR-200b
Stem-Loop bta-mir-200b
Sequence
uaauacugccugguaaugaug
Get sequence
Deep sequencing23516 reads, 76 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).