Mature sequence bta-let-7a-5p

Accession numberMIMAT0003844
IDbta-let-7a-5p
Previous IDsbta-let-7a
Stem-Loop bta-let-7a-1 bta-let-7a-2 bta-let-7a-3
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing22388600 reads, 78 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2