Mature sequence hsa-miR-766-3p

Accession numberMIMAT0003888
IDhsa-miR-766-3p
Previous IDshsa-miR-766
Stem-Loop hsa-mir-766
Sequence
acuccagccccacagccucagc
Get sequence
Deep sequencing6345 reads, 145 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).