Mature sequence mdo-miR-200a-3p

Accession numberMIMAT0004158
IDmdo-miR-200a-3p
Previous IDsmdo-miR-200a
Stem-Loop mdo-mir-200a
Sequence
uaacacugucugguaacgaugu
Get sequence
Deep sequencing41599 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1