Mature sequence mdo-miR-200a-3p

• Accession number: MIMAT0004158
• ID: mdo-miR-200a-3p
• Previous IDs: mdo-miR-200a
• Stem-Loop: mdo-mir-200a
• Sequence: uaacacugucugguaacgaugu
• Deep sequencing: 41599 reads, 5 experiments
• Database links:
  • RNAcentral:URS000008DA94_13616
• Predicted targets:
  • TargetScanVert:mdo-miR-200a-3p

References

1. PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).