Mature sequence mdo-let-7d

Accession numberMIMAT0004172
IDmdo-let-7d
Stem-Loop mdo-let-7d
Sequence
agagguaguagguugcauagu
Get sequence
Deep sequencing121786 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1