Mature sequence hsa-miR-802

Accession numberMIMAT0004185
IDhsa-miR-802
Stem-Loop hsa-mir-802
Sequence
caguaacaaagauucauccuugu
Get sequence
Deep sequencing1618 reads, 6 experiments
Predicted targets

References

1
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).