Mature sequence bta-miR-126-5p

Accession numberMIMAT0004328
IDbta-miR-126-5p
Previous IDsbta-miR-126*
Stem-Loop bta-mir-126
Sequence
cauuauuacuuuugguacgcg
Get sequence
Deep sequencing503370 reads, 65 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3