Mature sequence bta-let-7a-3p

Accession numberMIMAT0004330
IDbta-let-7a-3p
Previous IDsbta-let-7a*
Stem-Loop bta-let-7a-3
Sequence
cuauacaaucuacugucuuuc
Get sequence
Deep sequencing4600 reads, 74 experiments
Predicted targets

References

1