Mature sequence bta-let-7b

Accession numberMIMAT0004331
IDbta-let-7b
Stem-Loop bta-let-7b
Sequence
ugagguaguagguugugugguu
Get sequence
Deep sequencing3777147 reads, 77 experiments
Predicted targets

References

1
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).