Mature sequence bta-let-7c

Accession numberMIMAT0004332
IDbta-let-7c
Stem-Loop bta-let-7c
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing7121024 reads, 78 experiments
Predicted targets

References

1