Mature sequence bta-miR-15a

Accession numberMIMAT0004334
IDbta-miR-15a
Stem-Loop bta-mir-15a
Sequence
uagcagcacauaaugguuugu
Get sequence
Deep sequencing27283 reads, 75 experiments
Predicted targets

References

1