Mature sequence bta-miR-19b

Accession numberMIMAT0004337
IDbta-miR-19b
Stem-Loop bta-mir-19b bta-mir-19b-2
Sequence
ugugcaaauccaugcaaaacuga
Get sequence
Deep sequencing65402 reads, 76 experiments
Predicted targets

References

1
2
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).