Mature sequence bta-miR-34a

Accession numberMIMAT0004340
IDbta-miR-34a
Stem-Loop bta-mir-34a
Sequence
uggcagugucuuagcugguugu
Get sequence
Deep sequencing1409 reads, 70 experiments
Predicted targets

References

1