Mature sequence hsa-miR-361-3p

Accession numberMIMAT0004682
IDhsa-miR-361-3p
Stem-Loop hsa-mir-361
Sequence
ucccccaggugugauucugauuu
Get sequence
Deep sequencing50009 reads, 156 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).