Mature hsa-miR-338-5p
| Accession | MIMAT0004701 |
| Description | hsa-miR-338-5p mature miRNA |
| Hairpins | |
| Sequence | AACAAUAUCCUGGUGCUGAGUG |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30871575 | occurs_in CL:0000576 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30451334 | has_input UniProtKB:P04156 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30871575 | occurs_in CL:0000576 |
| involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30871575 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30451334 | has_input UniProtKB:P04156 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30871575 | |
| involved_in | GO:1900016 negative regulation of cytokine production involved in inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30871575 | has_input UniProtKB:P05231 |
| located_in | GO:0070062 extracellular exosome |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:30871575 | part_of UBERON:0001969 |
