Mature sequence hsa-miR-339-3p

• Accession number: MIMAT0004702
• ID: hsa-miR-339-3p
• Stem-Loop: hsa-mir-339
• Sequence: ugagcgccucgacgacagagccg
• Deep sequencing: 38862 reads, 158 experiments
• Database links:
  • RNAcentral:URS000055B190_9606
• Predicted targets:
  • TargetMiner:hsa-miR-339-3p
  • TargetScanVert:hsa-miR-339-3p
  • miRDB:hsa-miR-339-3p
  • microrna.org:hsa-miR-339-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).