Mature sequence rno-miR-135a-3p

Accession numberMIMAT0004732
IDrno-miR-135a-3p
Previous IDsrno-miR-135a*
Stem-Loop rno-mir-135a
Sequence
uguagggauggaagccaugaaa
Get sequence
Deep sequencing2273 reads, 177 experiments
Predicted targets

References

1
PMID:16471176 "Assessment of the microRNA system in salt-sensitive hypertension" Naraba H, Iwai N Hypertens Res. 28:819-826(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).