Mature sequence mmu-miR-343

Accession numberMIMAT0004868
IDmmu-miR-343
Stem-Loop mmu-mir-343
Sequence
ucucccuucaugugcccaga
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).