Mature mmu-miR-466g
| Accession | MIMAT0004883 |
| Description | mmu-miR-466g mature miRNA |
| Hairpins | |
| Sequence | AUACAGACACAUGCACACACA |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:1902306 negative regulation of sodium ion transmembrane transport |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26911843 | occurs_in CL:1001225 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26911843 | has_input UniProtKB:Q9WVC6 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26911843 | has_input UniProtKB:Q9WVC6 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26911843 | has_input UniProtKB:Q9WVC6 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24389345 | has_input UniProtKB:Q9WV30 |
| involved_in | GO:1904045 cellular response to aldosterone |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26911843 | occurs_in CL:1001225 |
