Mature sequence hsa-miR-450b-5p

Accession numberMIMAT0004909
IDhsa-miR-450b-5p
Stem-Loop hsa-mir-450b
Sequence
uuuugcaauauguuccugaaua
Get sequence
Deep sequencing12949 reads, 149 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).