Accession | MIMAT0004936 |
Description | mmu-miR-873a-5p mature miRNA |
Hairpins | |
Sequence | GCAGGAACUUGUGAGUCUCCU |
Evidence |
experimental
cloned [2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27258785 | has_input UniProtKB:Q60855 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27258785 | has_input UniProtKB:Q60855 |
involved_in | GO:0062099 negative regulation of programmed necrotic cell death |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27258785 | occurs_in CL:0000746 |