Accession | MIMAT0004948 |
Description | hsa-miR-885-3p mature miRNA |
Hairpins | |
Sequence | AGGCAGCGGGGUGUAGUGGAUA |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24882581 | has_input UniProtKB:P41134 |
acts_upstream_of | GO:0016525 negative regulation of angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24882581 | occurs_in CL:2000008 |
acts_upstream_of | GO:0030336 negative regulation of cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24882581 | occurs_in CL:2000008 |
acts_upstream_of | GO:0030514 negative regulation of BMP signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24882581 | |
acts_upstream_of | GO:0060392 negative regulation of SMAD protein signal transduction |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24882581 | |
acts_upstream_of | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24882581 | occurs_in CL:2000008 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24882581 | has_input UniProtKB:P36894 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24882581 | has_input UniProtKB:P36894 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24882581 | has_input UniProtKB:P36894 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|