Mature sequence hsa-miR-939-5p

Accession numberMIMAT0004982
IDhsa-miR-939-5p
Previous IDshsa-miR-939
Stem-Loop hsa-mir-939
Sequence
uggggagcugaggcucugggggug
Get sequence
Deep sequencing144 reads, 62 experiments
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).