Mature sequence cre-miR1147.2

Accession numberMIMAT0005385
IDcre-miR1147.2
Stem-Loop cre-MIR1147
Sequence
ucucggccaagucuggcaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).